| 產(chǎn)品名稱 |
Yarrowia lipolytica (Wickerham et al.) van der Walt et von Arx |
| 商品貨號(hào) |
B168727 |
| Deposited As |
Candida oleophila Kaisha et Iizuka |
| Strain Designations |
CP 602 [CBS 8108, CCRC 21493] |
| Synonym |
Endomycopsis lipolytica Wickerham et al., Saccharomycopsis lipolytica (Wickerham et al.) Yarrow |
| Alternate State |
Candida lipolytica (Harrison) Diddens et Lodder |
| Application |
produces biomass produces citric acid citrate produces lactones produces mixtures of lactones used for flavors and aromas |
| Biosafety Level |
1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format |
freeze-dried |
| Type Strain |
yes
(type strain of Candida oleophila) |
| Disclosure |
This material is cited in a US or other Patent and may not be used to
infringe the claims. Depending on the wishes of the Depositor, ATCC may be
required to inform the Patent Depositor of the party to which the material was
furnished. This material may not have been produced or characterized by ATCC. |
| Preceptrol® |
no |
| Mating Type |
mating type B |
| Medium |
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
|
| Growth Conditions |
Temperature: 24°C to 26°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
AAGGATCATTATTGATTTTATCTATTTCTGTGGATTTCTGGTATATTACAGCGTCATTTTATCTCAATTATAACTATCAACAACGGATCTCTTGGCTCTCACATCGATGAAGAACGCAGCGAACCGCGATATTTTTTGTGACTTGCAGATGTGAATCATCAATCTTTGAACGCACATTGCGCGGTATGGCATTCCGTACCGCACGGATGGAGGAGCGTGTTCCCTCTGGGATCGCATTGCTTTCTTGAAATGGATTTTTTAAACTCTCAATTATTACGTCATTTCACCTCCTTCATCCGAGATTACCCGCTGAACTTAAG
D1D2 region of the 26S ribosomal RNA gene
CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAACCCTCGGGATTGTAATTTGAAGATTTGGCATTGGAGAAAGCTAACCCAAGTTGCTTGGAATAGTACGTCATAGAGGGTGACAACCCCGTCTGGCTAACCGTTCTCCATGTATTGCCTTATCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAACTCCATCTAAAGCTAAATACTGGTGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGGTGAAAAGAACTTTGAAAAGAGAGTGAAATAGTATGTGAAATTGTTGATAGGGAAGGAAATGAGTGGAGAGTGGCCGAGGTTTCAGCCGCCCCTCGTGGGCGGTGTACTGCCGACGCCGAGTCATCGATAGCGAGACGAGGGTTACAAATGGGAGCGCCTTCGGGCGTTCTCCCCTAACCCTCCACACTGCCACCGACGACATAATCCACCCATTTCA
|
| Name of Depositor |
H Iizuka |
| U.S. Patent Number |
|
| Isolation |
Jet fuel (kerosene) |
| References |
Iizuka H, et al. Process for the production of citric acid by fermentation. US Patent 3,622,455 dated Nov 23 1971
Farbood ML, et al. Flavoring with mixtures of lactones. US Patent 4,960,597 dated Oct 2 1990
German Patent 1,812,710
Sprenger B, Rehm HJ. Biomass production by Candida species from n-alkanes in a film-submerged reactor in comparison with known culture methods. Eur. J. Appl. Microbiol. Biotechnol. 17: 64-68, 1983.
Knutsen AK, et al. Polyphasic re-examination of Yarrowia lipolytica strains and the description of three novel Candida species: Candida oslonensis sp. nov., Candida alimentaria sp. nov. and Candida hollandica sp. nov. Int. J. Syst. Evol. Microbiol. 57: 2426-2435, 2007. PubMed: 17911320
type strain of Candida oleophila
|
