| 產(chǎn)品名稱 | Saccharomyces cerevisiae Meyen ex E.C. Hansen |
|---|---|
| 商品貨號 | B167275 |
| Deposited As | Saccharomyces carlsbergensis Hansen |
| Classification | Saccharomycetes, Saccharomycetidae, Saccharomycetales, Saccharomycetaceae, Saccharomycetaceae, Saccharomyces, cerevisiae |
| Strain Designations | 4228 [ATCC 24904, ATCC 46991, BI CZAS 0323/1, CBS 2354, CCRC 20855, CCY 48-76, DBVPG 6248, DSM 70424, IFO 0565, NCYC 74, NRRL Y-1089, VKM-366, VKPM Y-830, VTT C-66065] |
| Alternate State | Candida robusta Diddens et Lodder |
| Application | Assay of pantothenic acid Assay of pyridoxal Assay of pyridoxamine Assay of pyridoxine vitamin B6 Assay of vitamin B6 complex Ferments maltose Produces alpha-glucosidase maltase Produces ergosterol Produces nicotinic acid niacin Produces pyrophosphatases Produces yeast proteinase B inhibitor proteinase B inhibitor IB3 Food testing Produces niacin-related compounds Produces endo-deoxyribonuclease A Produces alpha-glucosidase in brewery waste Reduces 3-methoxy-8(14)-seco-1,3,5(10),9,(11)-estratetraene-14,17-dione |
| Biosafety Level | 1
Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country. |
| Product Format | freeze-dried |
| Storage Conditions | Frozen: -80°C or colder Freeze-Dried: 2°C to 8°C Live Culture: See Propagation Section |
| Type Strain | no |
| Preceptrol® | no |
| Ploidy | diploid |
| Comments | Alpha-glucosidase synthesis NADH oscillations Spatio-temporal organization Induction of giant cells Sterol synthesis Does not carry 2 micron DNA plasmid. Genetics and biochemistry Respiration Oscillation in glycolysis |
| Morphology | On YM medium at 25°C after 2 days, colonies white to dingy white, smooth, dull, butyrous, margin entire. Cells hyaline, broadly ovoid, smooth, 4.5-9 X 4-6 μm. Pseudohyphae not observed. |
| Medium | ATCC® Medium 200: YM agar or YM broth ATCC® Medium 1245: YEPD ATCC® Medium 28: Emmons' modification of Sabouraud's agar |
| Growth Conditions | Temperature: 25°C to 30°C Atmosphere: Typical aerobic |
| Sequenced Data |
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence
TAATTTTGAAAATGGATTTTTTTTGTTTTGGCAAGAGCATGAGAGCTTTTACTGGGCAAGAAGACAAGAGATGGAGAGTCCAGCCGGGCCTGCGCTTAAGTGCGCGGTCTTGCTAGGCTTGTAAGTTTCTTTCTTGCTATTCCAAACGGTGAGAGATTTCTGTGCTTTTGTTATAGGACAATTAAAACCGTTTCAATACAACACACTGTGGAGTTTTCATATCTTTGCAACTTTTTCTTTGGGCATTCGAGCAATCGGGGCCCAGAGGTAACAAACACAAACAATTTTATTTATTCATTAAATTTTTGTCAAAAACAAGAATTTTCGTAACTGGAAATTTTAAAATATTAAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACATTCTGTTTGGTAGTGAGTGATACTCTTTGGAGTTAACTTGAAATTGCTGGCCTTTTCATTGGATGTTTTTTTTTCCAAAGAGAGGTTTCTCTGCGTGCTTGAGGTATAATGCAAGTACGGTCGTTTTAGGTTTTACCAACTGCGGCTAATCTTTTTTATACTGAGCGTATTGGAACGTTATCGATAAGAAGAGAGCGTCTAGGCGAACAATGTTCTTAAAGTTTGACCTCAAATCAGGTAGGAGTACCCGCTGAACTTAAGCATATCAATAA D1D2 region of the 26S ribosomal RNA gene ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGGAGAGGGCAACTTTGGGGCCGTTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGAGTGCGGTTCTTTGTAAAGTGCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGTGCCCTCTGCTCCTTGTGGGTAGGGGAATCTCGCATTTCACTGGGCCAGCATCAGTTTTGGTGGCAGGATAAATCCATAGGAATGTAGCTTGCCTCGGTAAGTATTATAGCCTGTGGGAATACTGCCAGCTGGGACTGAGGACTGCGACGTAAGTCAAGGATGCTGGCATAATGGTTATATGCCGC |
| Name of Depositor | RE Eakin |
| Isolation | Not available |
| Cross References | Nucleotide (GenBank) : KU729073 ITS including 5.8S rRNA gene Nucleotide (GenBank) : KU729159 D1/D2 region of 28S rRNA gene |
| References | Matern H, et al. Isolation, characterization and localization of the proteinase B inhibitor IB3 from Saccharomyces carlsbergensis. Eur. J. Biochem. 101: 325-332, 1979. PubMed: 118002 Hata S, et al. Involvement of cytochrome P-450 in delta22-desaturation in ergosterol biosynthesis of yeast. Biochem. Biophys. Res. Commun. 103: 272-277, 1981. PubMed: 7032523 Gibian H, et al. Production of optically active antipodes. US Patent 3,562,112 dated Feb 9 1971 Ando T, et al. Novel endo-deoxyribonuclease and process for the production thereof. European Patent Office Publ. No. 0060465A2 dated Sep 9 1982 Nishikawa Y, et al. Thiamine-induced alteration in sterol composition of Saccharomyces carlsbergensis 4228. Biochim. Biophys. Acta 531: 86-95, 1978. PubMed: 708751 Baumstark-Khan C, et al. Radiation induced formation of giant cells in Saccharomyces uvarum. II. Effect of X-rays on septum formation. Radiat. Environ. Biophys. 24: 9-16, 1985. PubMed: 3975354 Tubb RS. 2pm DNA plasmid in brewery yeasts. J Inst Brew 86: 78-80, 1980. Berge AM. Genes for the fermentation of maltose and -methylglucoside in Saccharomyces carlsbergensis. Mol. Gen. Genet. 115: 80-88, 1972. PubMed: 5018453 Lichko L, Okorokov L. Purification and some properties of membrane-bound and soluble pyrophosphatases of yeast vacuoles. Yeast 7: 805-812, 1991. PubMed: 1664997 Baumstark-Khan C, et al. Radiation induced formation of giant cells (Saccharomyces uvarum). I. Budding process and chitin ring formation. Radiat. Environ. Biophys. 23: 19-30, 1984. PubMed: 6709826 Kreuzberg KH, Betz A. Amplitude and period length of yeast NADH oscillations fermenting on different sugars in dependence of growth phase, starvation and hexose concentration. J Interdiscip Cycle Res 10: 41-50, 1979. . . Adv. Biotechnol. 2: 225-230, 1981. Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells in a phosphate limited continuous culture. Biotechnol. Lett. 13: 97-100, 1991. Jacobsen H, et al. Spontaneous spatio-temporal organization in yeast cell suspension. J. Cell Sci. 43: 367-377, 1980. PubMed: 7419625 Arnezeder C, Hampel WA. Influence of growth rate on the accumulation of ergosterol in yeast cells. Biotechnol. Lett. 12: 277-282, 1990. Berge AM, et al. Regulation of maltose fermentation in Saccharomyces carlsbergensis. I. The function of the gene MAL6, as recognized by mal6-mutants. Mol. Gen. Genet. 123: 233-246, 1973. PubMed: 4731427 Das J, Busse HG. Analysis of the dynamics of relaxation type oscillation in glycolysis of yeast extracts. Biophys. J. 60: 369-379, 1991. PubMed: 1832975 AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in food extracts, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 961.15. AOAC International Vitamin B6 (pyridoxine, pyridoxal, pyridoxamine) in ready-to-feed milk-based infant formula, microbiological method. Gaithersburg, MD:AOAC International;AOAC "Official Methods of Analysis of the AOAC International" 985.32. Shin M, et al. Effect of L-tryptophan and L-leucine on biosynthesis of niacin-related compounds in Saccharomyces carlsbergensis. J. Nutr. Sci. Vitaminol. 28: 179-189, 1982. PubMed: 6215472 Atkin L, et al. Yeast microbiological methods for determination of vitamins. Pyridoxine. Ind. Eng. Chem. 15: 141-144, 1923. Appleyard JG, Stanley DA. The evaluation of the vitamin B 6 status in children with convulsions. Med. Lab. Technol. 29: 160-170, 1972. PubMed: 5071462 Itagaki T, Tsukahara T. Microbiological assay of vitamin B 6 by thin-layer cup-plate method with Saccharomyces carlsbergensis. J. Vitaminol. 18: 90-96, 1972. Windevoxhel M, Bahar S. Production of intracellular alpha-glucosidase in brewery waste by Saccharomyces carlsbergensis. Acta Cient. Venez. 40: 40-45, 1989. PubMed: 2700112 Tsuji K. Liquid nitrogen preservation of Saccharomyces carlsbergensis and its use in a rapid biological assay of pantothenic acid. Appl. Microbiol. 14: 462-465, 1966. PubMed: 5970831 van der Zeijst BA, et al. In vitro protein synthesis in yeast polyuridylic acid-dependent incorporations of phenylalanine into endogenous peptidyl transfer RNA. Biochim. Biophys. Acta 294: 517-526, 1973. PubMed: 4705999 de Kroon RA, Koningsberger VV. An inducible transport system for alpha-glucosides in protoplasts of Saccharomyces carlsbergensis. Biochim. Biophys. Acta 204: 590-609, 1970. PubMed: 5441195 Foodstuffs --- Determination of vitamin B6 by microbiological assay. London, UK:British Standards Institution;British Standard DD ENV 14166:2001. Stolz J, Vielreicher M. Tpn1p, the plasma membrane vitamin B6 transporter of Saccharomyces cerevisiae. J. Biol. Chem. 278: 18990-18996, 2003. PubMed: 12649274 |
| 梅經(jīng)理 | 17280875617 | 1438578920 |
| 胡經(jīng)理 | 13345964880 | 2438244627 |
| 周經(jīng)理 | 17757487661 | 1296385441 |
| 于經(jīng)理 | 18067160830 | 2088210172 |
| 沈經(jīng)理 | 19548299266 | 2662369050 |
| 李經(jīng)理 | 13626845108 | 972239479 |
